Strain Information | |
---|---|
DGRC Number | 113183 |
Genotype with FlyBase Link | y[*] w[*]; P{w[+mW.hs]=GawB}ptc[NP3253] / CyO, P{w[-]=UAS-lacZ.UW14}UW14 |
Genotype | y* w*; P{w+mW.hs=GawB}ptcNP3253 / CyO, P{w-=UAS-lacZ.UW14}UW14 |
Break points/Insertion Site | 44D8 |
Map Viewer | |
Related Genes | ptc CG30353 CG8635 |
Original Number | 3253 |
Chromosome | 2 |
Comments | FlyBase Insertion: P{GawB}NP3253 NP line. Received from the National Institute of Genetics. |
Balancer | CyUW14 |
Cluster id | 600 |
General Information | NP_lines |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Embryonic Expression | epi strip (TU) |
Larval GFP | cns, epi |
Larval X-gal | center of antenna, |
Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
Last update | 2020-04-03 |
Research papers using this strain [Please submit your publication] |
Fuse N, Hashiba H, Ishibashi K, Suzuki T, Nguyen QD, Fujii K, Ikeda-Ohtsubo W, Kitazawa H, Tanimoto H, Kurata S. Neural control of redox response and microbiota-triggered inflammation in Drosophila gut. Front Immunol (2023) 14 1268611 [PubMed ID = 37965334] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
Stock Request |
Library & Clone Information |
---|
Library Name / Clone Name | np / np36135_0907 |
Strand | Plus |
Insertion Point | 3716376 |
Chromosome Band | 2R |
Flanking Sequence | gcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggaccaccttatgtt atttcatcatgGTCTGAGGTCTCGGCGAAGCAAGACATAACAACGGCCCGACAGAGAGAG AGAAGAAAAATCGGGAGAATTATGAAGACATTAACTCGACCACACAGCACGCTGCCGTAC CCGTACCTATATACCTATACCCAACCCATAACCATACACACACACACACGCATCAACACA CACACACACGAACAGACNGGCCCAAAAACTCGAAACCCCAGCAGAGAGAAGNGGGGGCTT ACTTACGTTACgatcgaagaatacataagagagaaccgtcgccaaagaacccattattgg tggggtccgttttcaggaagggcaagccatccgacatgtnatnctcttcagaccaatcaa atccatgaagagcatccctgggcataaaatccaacggaattgnggagttatcatgatgag ctgccgagtcaatcgatacagncaactgtcttttgacctttgttactactctcttncgat gatgatgtcgcacttattctatgctgtctcantgtnagaggcatatcagtctccactgag catnttnttttttgggggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnn |
Image Files | ||
---|---|---|
Disc |
|